261706
Larvae of Ascaris undergo second moulting in
1 Inside the egg
2 Alveoli of lungs of man
3 Intestine of man
4 Inside the uterus of parent
Explanation:
B The larvae of Ascaris undergo second and third moulting occurs in the lungs. - The larvae undergo first moulting in the soil. - The second stage larva goes from soil to lungs. - Larvae hatch from the eggs in your small intestine which is the first moult.
TS EAMCET-31.07.2022 Shift-I
Animal kingdom
261716
Which of the following is/are grouped under phanerogams?
1 Angiosperms
2 Gymnosperms
3 Pteridophytes
4 Both (a) and (b)
Explanation:
D Phanerogams are plant that bear seeds as well as flower compared to other plants. Spermatophytes are another term for these individuals. The plants body is divided into three parts - The root, the stem and leaves. - Gymnosperms and angiosperms are categorized under phanerogams. - They have well developed vascular system. - The seeds are present without a seed coat in the gymnosperms (cycas, pinus) while the fully developed seed is present in angiosperm (Mango, pear etc).
UP CPMT-2008
Animal kingdom
261726
Genetic map is one that
1 Shows the stages during the cell division
2 Shows the distribution of various species in a region
3 Establishes sites of the genes on a chromosome
4 Establishes the various stages in gene evolution
Explanation:
C A genetic map (linkage map)shows the relative location of genetic markers (reflecting sites of genomic variants) on a chromosome. - A genetic map is based on the concept of genetic linkage Genetic Map Cylogenelic: Kap P'yeles kap: DNA sequene: ATCAGTAGCATGCATGCATGCATGC - The closer two markers are to each other on a chromosome, the higher the probability that they will be inherited together. - By studying inherited patterns, the relative order and location of genetic markers along a chromosome can be established. Concluded, genetic map is one that stablishes sites of the genes on a chromosome.
MGIMS Wardha-2010
Animal kingdom
261704
Haemocoel is found in
1 Hydra and Aurelia
2 Taenia and Ascaris
3 Cockroach and Pila
4 Balanoglossus and Herdmania
Explanation:
C Haemocoel is the body cavity which is filled with blood or (haemolymph). It is generally found in arthropods and molluscs e.g. Periplaneta and Pila. These do not posses an arrangement of blood vesseles like those in mammals. Haemocoel develop from part of the blood system.
BCECE-2014 / UP CPMT-2011 BVP-2007 / MGIMS Wardha-2006
Animal kingdom
261705
Heart in fishes is described as
1 Nurogenic and bronchial heart
2 Myogenic, bronchial and venous heart
3 Neurogenic and venous heart
4 Neurogenic and alternate heart
Explanation:
B The fish heart, like other vertebrates, is myogenic, possessing a pacemaker tissue that triggers action potentials slowly and spontaneously. The heart in fishes is described as bronchial heart because its main function is to pump venous blood to ventral aorta into gills and to somatic vasculature. - Fish heart is two chambered, consisting of an auricle and a ventricle. Fishes have venous type of heart.
261706
Larvae of Ascaris undergo second moulting in
1 Inside the egg
2 Alveoli of lungs of man
3 Intestine of man
4 Inside the uterus of parent
Explanation:
B The larvae of Ascaris undergo second and third moulting occurs in the lungs. - The larvae undergo first moulting in the soil. - The second stage larva goes from soil to lungs. - Larvae hatch from the eggs in your small intestine which is the first moult.
TS EAMCET-31.07.2022 Shift-I
Animal kingdom
261716
Which of the following is/are grouped under phanerogams?
1 Angiosperms
2 Gymnosperms
3 Pteridophytes
4 Both (a) and (b)
Explanation:
D Phanerogams are plant that bear seeds as well as flower compared to other plants. Spermatophytes are another term for these individuals. The plants body is divided into three parts - The root, the stem and leaves. - Gymnosperms and angiosperms are categorized under phanerogams. - They have well developed vascular system. - The seeds are present without a seed coat in the gymnosperms (cycas, pinus) while the fully developed seed is present in angiosperm (Mango, pear etc).
UP CPMT-2008
Animal kingdom
261726
Genetic map is one that
1 Shows the stages during the cell division
2 Shows the distribution of various species in a region
3 Establishes sites of the genes on a chromosome
4 Establishes the various stages in gene evolution
Explanation:
C A genetic map (linkage map)shows the relative location of genetic markers (reflecting sites of genomic variants) on a chromosome. - A genetic map is based on the concept of genetic linkage Genetic Map Cylogenelic: Kap P'yeles kap: DNA sequene: ATCAGTAGCATGCATGCATGCATGC - The closer two markers are to each other on a chromosome, the higher the probability that they will be inherited together. - By studying inherited patterns, the relative order and location of genetic markers along a chromosome can be established. Concluded, genetic map is one that stablishes sites of the genes on a chromosome.
MGIMS Wardha-2010
Animal kingdom
261704
Haemocoel is found in
1 Hydra and Aurelia
2 Taenia and Ascaris
3 Cockroach and Pila
4 Balanoglossus and Herdmania
Explanation:
C Haemocoel is the body cavity which is filled with blood or (haemolymph). It is generally found in arthropods and molluscs e.g. Periplaneta and Pila. These do not posses an arrangement of blood vesseles like those in mammals. Haemocoel develop from part of the blood system.
BCECE-2014 / UP CPMT-2011 BVP-2007 / MGIMS Wardha-2006
Animal kingdom
261705
Heart in fishes is described as
1 Nurogenic and bronchial heart
2 Myogenic, bronchial and venous heart
3 Neurogenic and venous heart
4 Neurogenic and alternate heart
Explanation:
B The fish heart, like other vertebrates, is myogenic, possessing a pacemaker tissue that triggers action potentials slowly and spontaneously. The heart in fishes is described as bronchial heart because its main function is to pump venous blood to ventral aorta into gills and to somatic vasculature. - Fish heart is two chambered, consisting of an auricle and a ventricle. Fishes have venous type of heart.
261706
Larvae of Ascaris undergo second moulting in
1 Inside the egg
2 Alveoli of lungs of man
3 Intestine of man
4 Inside the uterus of parent
Explanation:
B The larvae of Ascaris undergo second and third moulting occurs in the lungs. - The larvae undergo first moulting in the soil. - The second stage larva goes from soil to lungs. - Larvae hatch from the eggs in your small intestine which is the first moult.
TS EAMCET-31.07.2022 Shift-I
Animal kingdom
261716
Which of the following is/are grouped under phanerogams?
1 Angiosperms
2 Gymnosperms
3 Pteridophytes
4 Both (a) and (b)
Explanation:
D Phanerogams are plant that bear seeds as well as flower compared to other plants. Spermatophytes are another term for these individuals. The plants body is divided into three parts - The root, the stem and leaves. - Gymnosperms and angiosperms are categorized under phanerogams. - They have well developed vascular system. - The seeds are present without a seed coat in the gymnosperms (cycas, pinus) while the fully developed seed is present in angiosperm (Mango, pear etc).
UP CPMT-2008
Animal kingdom
261726
Genetic map is one that
1 Shows the stages during the cell division
2 Shows the distribution of various species in a region
3 Establishes sites of the genes on a chromosome
4 Establishes the various stages in gene evolution
Explanation:
C A genetic map (linkage map)shows the relative location of genetic markers (reflecting sites of genomic variants) on a chromosome. - A genetic map is based on the concept of genetic linkage Genetic Map Cylogenelic: Kap P'yeles kap: DNA sequene: ATCAGTAGCATGCATGCATGCATGC - The closer two markers are to each other on a chromosome, the higher the probability that they will be inherited together. - By studying inherited patterns, the relative order and location of genetic markers along a chromosome can be established. Concluded, genetic map is one that stablishes sites of the genes on a chromosome.
MGIMS Wardha-2010
Animal kingdom
261704
Haemocoel is found in
1 Hydra and Aurelia
2 Taenia and Ascaris
3 Cockroach and Pila
4 Balanoglossus and Herdmania
Explanation:
C Haemocoel is the body cavity which is filled with blood or (haemolymph). It is generally found in arthropods and molluscs e.g. Periplaneta and Pila. These do not posses an arrangement of blood vesseles like those in mammals. Haemocoel develop from part of the blood system.
BCECE-2014 / UP CPMT-2011 BVP-2007 / MGIMS Wardha-2006
Animal kingdom
261705
Heart in fishes is described as
1 Nurogenic and bronchial heart
2 Myogenic, bronchial and venous heart
3 Neurogenic and venous heart
4 Neurogenic and alternate heart
Explanation:
B The fish heart, like other vertebrates, is myogenic, possessing a pacemaker tissue that triggers action potentials slowly and spontaneously. The heart in fishes is described as bronchial heart because its main function is to pump venous blood to ventral aorta into gills and to somatic vasculature. - Fish heart is two chambered, consisting of an auricle and a ventricle. Fishes have venous type of heart.
261706
Larvae of Ascaris undergo second moulting in
1 Inside the egg
2 Alveoli of lungs of man
3 Intestine of man
4 Inside the uterus of parent
Explanation:
B The larvae of Ascaris undergo second and third moulting occurs in the lungs. - The larvae undergo first moulting in the soil. - The second stage larva goes from soil to lungs. - Larvae hatch from the eggs in your small intestine which is the first moult.
TS EAMCET-31.07.2022 Shift-I
Animal kingdom
261716
Which of the following is/are grouped under phanerogams?
1 Angiosperms
2 Gymnosperms
3 Pteridophytes
4 Both (a) and (b)
Explanation:
D Phanerogams are plant that bear seeds as well as flower compared to other plants. Spermatophytes are another term for these individuals. The plants body is divided into three parts - The root, the stem and leaves. - Gymnosperms and angiosperms are categorized under phanerogams. - They have well developed vascular system. - The seeds are present without a seed coat in the gymnosperms (cycas, pinus) while the fully developed seed is present in angiosperm (Mango, pear etc).
UP CPMT-2008
Animal kingdom
261726
Genetic map is one that
1 Shows the stages during the cell division
2 Shows the distribution of various species in a region
3 Establishes sites of the genes on a chromosome
4 Establishes the various stages in gene evolution
Explanation:
C A genetic map (linkage map)shows the relative location of genetic markers (reflecting sites of genomic variants) on a chromosome. - A genetic map is based on the concept of genetic linkage Genetic Map Cylogenelic: Kap P'yeles kap: DNA sequene: ATCAGTAGCATGCATGCATGCATGC - The closer two markers are to each other on a chromosome, the higher the probability that they will be inherited together. - By studying inherited patterns, the relative order and location of genetic markers along a chromosome can be established. Concluded, genetic map is one that stablishes sites of the genes on a chromosome.
MGIMS Wardha-2010
Animal kingdom
261704
Haemocoel is found in
1 Hydra and Aurelia
2 Taenia and Ascaris
3 Cockroach and Pila
4 Balanoglossus and Herdmania
Explanation:
C Haemocoel is the body cavity which is filled with blood or (haemolymph). It is generally found in arthropods and molluscs e.g. Periplaneta and Pila. These do not posses an arrangement of blood vesseles like those in mammals. Haemocoel develop from part of the blood system.
BCECE-2014 / UP CPMT-2011 BVP-2007 / MGIMS Wardha-2006
Animal kingdom
261705
Heart in fishes is described as
1 Nurogenic and bronchial heart
2 Myogenic, bronchial and venous heart
3 Neurogenic and venous heart
4 Neurogenic and alternate heart
Explanation:
B The fish heart, like other vertebrates, is myogenic, possessing a pacemaker tissue that triggers action potentials slowly and spontaneously. The heart in fishes is described as bronchial heart because its main function is to pump venous blood to ventral aorta into gills and to somatic vasculature. - Fish heart is two chambered, consisting of an auricle and a ventricle. Fishes have venous type of heart.
261706
Larvae of Ascaris undergo second moulting in
1 Inside the egg
2 Alveoli of lungs of man
3 Intestine of man
4 Inside the uterus of parent
Explanation:
B The larvae of Ascaris undergo second and third moulting occurs in the lungs. - The larvae undergo first moulting in the soil. - The second stage larva goes from soil to lungs. - Larvae hatch from the eggs in your small intestine which is the first moult.
TS EAMCET-31.07.2022 Shift-I
Animal kingdom
261716
Which of the following is/are grouped under phanerogams?
1 Angiosperms
2 Gymnosperms
3 Pteridophytes
4 Both (a) and (b)
Explanation:
D Phanerogams are plant that bear seeds as well as flower compared to other plants. Spermatophytes are another term for these individuals. The plants body is divided into three parts - The root, the stem and leaves. - Gymnosperms and angiosperms are categorized under phanerogams. - They have well developed vascular system. - The seeds are present without a seed coat in the gymnosperms (cycas, pinus) while the fully developed seed is present in angiosperm (Mango, pear etc).
UP CPMT-2008
Animal kingdom
261726
Genetic map is one that
1 Shows the stages during the cell division
2 Shows the distribution of various species in a region
3 Establishes sites of the genes on a chromosome
4 Establishes the various stages in gene evolution
Explanation:
C A genetic map (linkage map)shows the relative location of genetic markers (reflecting sites of genomic variants) on a chromosome. - A genetic map is based on the concept of genetic linkage Genetic Map Cylogenelic: Kap P'yeles kap: DNA sequene: ATCAGTAGCATGCATGCATGCATGC - The closer two markers are to each other on a chromosome, the higher the probability that they will be inherited together. - By studying inherited patterns, the relative order and location of genetic markers along a chromosome can be established. Concluded, genetic map is one that stablishes sites of the genes on a chromosome.
MGIMS Wardha-2010
Animal kingdom
261704
Haemocoel is found in
1 Hydra and Aurelia
2 Taenia and Ascaris
3 Cockroach and Pila
4 Balanoglossus and Herdmania
Explanation:
C Haemocoel is the body cavity which is filled with blood or (haemolymph). It is generally found in arthropods and molluscs e.g. Periplaneta and Pila. These do not posses an arrangement of blood vesseles like those in mammals. Haemocoel develop from part of the blood system.
BCECE-2014 / UP CPMT-2011 BVP-2007 / MGIMS Wardha-2006
Animal kingdom
261705
Heart in fishes is described as
1 Nurogenic and bronchial heart
2 Myogenic, bronchial and venous heart
3 Neurogenic and venous heart
4 Neurogenic and alternate heart
Explanation:
B The fish heart, like other vertebrates, is myogenic, possessing a pacemaker tissue that triggers action potentials slowly and spontaneously. The heart in fishes is described as bronchial heart because its main function is to pump venous blood to ventral aorta into gills and to somatic vasculature. - Fish heart is two chambered, consisting of an auricle and a ventricle. Fishes have venous type of heart.